top of page

CURRENT ISSUE

April 2023

Malay. J. Biochem. Mol. Biol. (2023) 26 (1)

TABLE OF CONTENTS

Page 1- 9

Anh Cam Ha, Tan Minh Le & Chinh Duc Nguyen Pham

OPTIMIZATION OF Artocarpus altilis L. EXTRACT FOR XANTHINE OXIDASE INHIBITORY ACTIVITIES USING RESPONSE SURFACE METHODOLOGY (RSM)

Abstract 

Artocarpus altilis is widely used in traditional medicine, especially in Vietnam. Many studies have reported the bioactivities of A. altilis in anti-diabetes, while its anti-gout activity has not received much interest. In this study, extraction conditions of A. altilis were comprehensively optimized by the response surface methodology (RSM) for the xanthine oxidase inhibitory activity. Furthermore, the effects of the maturity stage on phytochemicals and the xanthine oxidase inhibitory activity of A. altilis leaves were assessed. The results indicated that the old leaves were appropriate materials for anti-xanthine oxidase. Under the optimal conditions at ethanol concentration 79.74 %, time extraction 76.68 min, and solid-to-liquid ratio 1:9.56 g:mL, the value of IC50 in xanthine oxidase inhibitory activity reached 2.67 μg/mL, nine times less than that of crude extract (24.14 μg/mL). The biological activity of the optimal sample also showed the potentiality of inhibition of α-glucosidase enzyme and antioxidant with IC50 values of 64.83 μg/mL and 1.88 μg/mL, respectively.

Full text

Page 10 - 21

Anjana Chamilka Thuduhenage Dona, Nurul Hammizah Hamidon and Nurhidanatasha Abu Bakar

A REVIEW OF THE ANTIPARASITIC EFFECTS OF ELLAGIC ACID AND OTHER PHENOLIC COMPOUNDS ISOLATED FROM MEDICINAL PLANTS

Abstract 

The pursuit of alternative sources for antiparasitic drugs is crucial due to the frequent inadequacy of current treatments and the potential development of resistance among parasites towards synthetic therapies. Conversely, medicinal plants have garnered prominent attention as they produce various natural compounds with intriguing biological properties that can be beneficial in treating parasitic infections. This article presents a comprehensive overview of past literature regarding the topic. It specifically focuses on the antiparasitic effects of ellagic acid and other phenolic compounds against parasites, such as Plasmodium, Trypanosoma, Leishmania, and Helminths. The findings hope to contribute further understanding of the utilisation of ellagic acid and other phenolic compounds as innovative antiparasitic drugs for effectively managing parasitic infections. It also highlights potential limitations and sets the direction for future research.

Full text

Page 22 - 30

Elisha Apatewen Akanbong, Alparslan Kadir Devrim, Ali Şenol, Mert Sudagidan

COMPARISON OF SOME COPPER COMPOUNDS IN TERMS OF THEIR INTERACTIONS WITH DNA USING AGAROSE GEL ELECTROPHORESIS, UV-ABSORBANCE AND FLUORESCENCE SPECTROPHOTOMETRY TECHNIQUES

Abstract 

In this study, to investigate the interaction of genomic DNA with some copper compounds (CuSO4, CuCO3, and CuCl2) at various concentrations (1000 μM, 500 μM, 250 μM, 125 μM and 62.5 μM); UV-absorbance spectrophotometry, agarose gel electrophoresis, and fluorescence spectrophotometry techniques were used. When the UV-spectrophotometry data were examined within the wavelength range of 220-320 nm, the hyperchromic effect of CuCl2 was evaluated to be proportional to its concentrations. Within the wavelength range, the copper compounds produced their strongest hyperchromic effect on the DNA at 1000 μM. When the fluorescent spectrophotometry data were evaluated, the hypochromic effect of CuCl2 within the wavelength range of 400-700 nm was determined at 1000 μM. CuSO4 showed a hypochromic effect at concentrations above 62.5 μM. Also, it was observed that CuCO3 did not interact with DNA. According to the agarose gel electrophoresis findings, the copper compounds investigated decreased DNA band intensity as their concentrations increased. It was observed that the most significant decrease in band intensity was caused by CuCl2 at 1000 μM. Again, it was observed that the copper compounds did not cause any cleavage in the genomic DNA within the concentration range of 62.5-1000 μM. Consequently, the copper compounds bind to DNA, most probably by non-intercalative mode. In this regard, they could have the potential to be used in the development of new therapeutic agents. Therefore, conducting further studies on the interaction of the copper compounds with DNA, their possible DNA uncoiling activities, and also the investigation of these compounds in cancer cell lines will provide useful results.

Full text

Page 31 - 41

Syubbanul Wathon, Ratis Nour Sholichah, Rike Oktarianti, Kartika Senjarini

REDESIGNING PRIMER OF CYTOCHROME OXIDASE SUBUNIT 1 (CO1) GENE FOR SPECIFIC IDENTIFICATION OF MALARIA VECTOR Anopheles sp.

Abstract 

Malaria remains a serious global health issue. Due to the absence of a malaria vaccine, vector control is deemed one of the most effective preventive strategies. Anopheles sp., with 20 species, is a vector of malaria in endemic areas across Indonesia. Identifying the vector of Anopheles sp. helps determine an effective and efficient vector control strategy. It is also important to determine disease epidemiology because different species have distinctive characteristics as malaria vectors. Several siblings and cryptic species are difficult to identify based on their morphological characteristics. These limitations have prompted the development of methods for species identification through DNA barcoding techniques. One of the molecular markers widely used in DNA barcoding is the Cytochrome Oxidase Subunit 1 (CO1) gene derived from mitochondrial DNA. This study aimed to redesign the CO1 primer with a database from Anopheles sp. for a more precise and accurate interpretation of Anopheles sp. The design of CO1 primer was developed through a bioinformatics approach using the Anopheles sp. in NCBI database system. The redesigned primer was applied to the genomic DNA sample of Anopheles sp. obtained from the landing collection which had been morphologically identified in advance. The molecular identification on the new CO1 primer was done by CO1 sequence amplification, purification of PCR results, sequencing, and data analysis. The redesigned CO1 primer was named sra-CO1 with a forward sequence of 5' CCCGGAGCATTTATTGGGGA 3' and a reverse sequence of 5' AACCTGTTCCTGCCCCATTT 3' with a product length of 247 bp. The sra-CO1 primer has been successfully used in the molecular identification of Anopheles vagus and Anopheles vagus limosus, with the accession number NCBI Anopheles vagus MK628547.1. These results prove that the sra-CO1 primer can be used in the molecular identification of the genus Anopheles sp.

Full text

Page 42 - 50

Mariyam Shabeea Ahmed, Siti Aqlima Ahmad, Mohd Yunus Shukor and Mohd Termizi Yusof

EFFECT OF ACRYLAMIDE ON THE DEGRADATION OF PALM-BASED USED COOKING OIL BY SINGLE AND CO-CULTURE ISOLATES OF Alcaligenes sp. AQ5-02 AND Serratia sp. AQ5-03

Abstract 

Acrylamide is found in the environment, food, and waste products such as palm-based used cooking oil (UCO). The presence of acrylamide is a threat due to its neurotoxic, genotoxic, teratogenic, and carcinogenic characteristics. These negative impacts have sparked an interest in microbe-mediated bioremediation of acrylamide. The aim of this study is to investigate the effect of various concentrations of acrylamide on the degradation of UCO as a sole carbon source by single and co-culture isolates of Alcaligenes sp. AQ5-02 and Serratia sp. AQ5-03. Using gravimetric analysis, different acrylamide concentrations ranging from 10-200 mg/L were shown to significantly reduce palm oil UCO degradation and bacterial growth in single and co-culture formulations. In the co-culture, there were significant differences between all acrylamide concentrations in terms of UCO degradation. The single and co-culture isolates were able to withstand 10 mg/L of acrylamide while degrading more than 50% of UCO. However, beyond 10 mg/L, there was a significant reduction in the degradation of UCO in both single and co-culture methods. Two-way ANOVA reveals a significant difference in the degradation and bacterial growth between the single and co-culture isolates of Alcaligenes sp. AQ5-02 and Serratia sp. AQ5-03 with varying acrylamide concentrations (p < 0.0001). In conclusion, the co-culture has greater degradation and better tolerance at all concentrations of acrylamide compared to single isolate cultures of Alcaligenes sp. AQ5-02 and Serratia sp. AQ5-03. The study provides insightful knowledge on the presence of xenobiotics in the bioremediation of hydrocarbons by single and co-culture.

Full text

Page 51 - 58

Fathmath Shaman Fareed, Nallammai Singaram

A MODIFIED RNA EXTRACTION PROTOCOL FOR SECONDARY METABOLITE-RICH AMOMUM SPECIES (ZINGIBERACEAE)

Abstract 

High-quality and pure RNA are necessary for transcriptomic studies using next-generation sequencing technologies (NGS). Peninsular Malaysian ginger species are well known for their therapeutic properties and high levels of secondary metabolites such as alkaloids, flavonoids, and aromatic compounds. The Amomum genus of this family is particularly well-known for its significant antioxidant and antimicrobial properties. Although many plant RNA extraction protocols have been developed in the past, the efficacy varies depending on the species and the plant and plant parts utilized. Therefore, this study aimed to compare different RNA extraction protocols and determine a protocol for the secondary-metabolite-rich ginger species of the Zingiberaceae family. RNA was extracted from fresh leaves, stems, roots, and rhizomes of Amomum genus using four different methods: a commercial kit, CTAB-LiCl, SDS-LiCl and SDS-Phenol. Based on the findings, the modified commercial kit produced high-quality, pure RNA for each plant tissue utilized, surpassing the other approaches. The findings of this study emphasize the importance of PVP, and β-ME in the extraction process, particularly in Zingiberaceae species with high secondary metabolites.

Full text

Page 59 - 65

Nor Azlianie A@A, Zunoliza A, Nurhanan MY, Nur Vicky B, Nor Jannah S and Mohd Hafidz Hadi A

ANTI-PROLIFERATIVE ACTIVITIES OF Tectona grandis LEAVES AGAINST SELECTED CANCER CELL LINES

Abstract 

Tectona grandis Linn (Teak), known locally as Sagwan, is a member of the Verbenaceae family. The leaves of this plant have been reported to contain various groups of compounds including anthraquinones, lignin derivatives, anthratectone and naphthatectone which are made up of several compounds such as verbascoside, isoverbascoside, abeograndinoic acid, tectoquinone, lapachol and deoxylapachol. Pharmacologically, the plant leaves have been studied for in vitro anticancer, antibacterial, antifungal, antiviral, antiprotozoal, insecticidal, anti-inflammatory and antipyretic properties. In this study, the methanol extract (TGM) of T. grandis leaves was subjected to tannin removal to yield 5 fractions consisting of TGF1 (100% water), TGF2 (50% methanol), TGF3 (100% methanol), TGF4 (5% acetic acid) and TGF5 (0.1N NaOH). The extract and fractions were assessed using the sulforhodamine B assay for anti-proliferative activities against ovarian, breast and colorectal cancer cell lines. The TGM extract showed moderately active anti-proliferative activities against A2780 (IC50 34.38 ± 0.94 μg/ml), SKOV-3 (IC50 37.73 ± 1.11 μg/ml), MCF-7 (IC50 50.94 ± 0.78 μg/ml) and HT-29 (IC50 49.67 ± 0.78 μg/ml) cancer cell lines. TGF4 fraction also showed moderately active anti-proliferative activity against A2780 (IC50 25.21 ± 0.52 μg/ml), SKOV-3 (IC50 33.49 ± 0.074 μg/ml), MCF-7 (IC50 32.80 ± 0.17 μg/ml) and HT-29 (IC50 33.05 ± 0.20 μg/ml) cancer cell lines as compared to other fractions, TGF1, TGF2, TGF3 and TGF5, which were not active. The chemical compounds present in the extract and fractions obtained were characterized and identified by chromatography analysis which are caffeic acid derivatives and flavonoid compounds.

Full text

Page 66 - 76

Nur Farhani Binti Mohd Ghani, Gurmeet Kaur Surindar Singh, Nurul Aqmar Mohd Nor Hazalin

NEUROPATHOLOGY OF STREPTOZOTOCIN-INDUCED RODENT MODELS OF ALZHEIMER’S DISEASE: A REVIEW ON BEHAVIORAL AND HISTOLOGICAL EVIDENCE

Abstract 

Alzheimer's disease (AD) is an incurable neurodegenerative disease with significant research efforts focused on developing effective treatments. Various rodent models, including transgenic and non-transgenic models, have been established to investigate AD and potential therapeutic interventions. Streptozotocin (STZ), a naturally alkylating antineoplastic agent with a diabetogenic effect on mammals is the widely used sporadic rodent AD model due to its ability to mimic certain aspects of sporadic AD observed in humans. Recent evidence has highlighted a correlation between STZ administration and AD-like neuropathology, characterized by exacerbated neuroinflammation and the manifestation of AD hallmarks in animals. However, certain key characteristics of STZ-induced AD pathology remain poorly described. Therefore, this review aims to summarize the neuropathological hallmarks of AD in rodents following STZ administration. STZ injection chronically produces multiple effects resembling AD's behavioural and pathological aspects. Rodents that received injections of STZ developed long-term progressive deficits of memory, learning and cognitive behaviour. Histologically, STZ affects neurons and synapses in the brain, accompanied by the presence of amyloid-beta (Aβ) plaques, tau hyperphosphorylation, white matter atrophy, and myelin damage. Understanding the connection between behavioural and neuropathological alterations following STZ administration and their relevance to AD pathology in rodents would significantly contribute to the field of AD animal models.

Full text

Page 77 - 82

Nur Azizah Nadhirah Binti Azni, Yong Qi Leong, Chooi Ling Lim, Khuen Yen Ng, Soi Moi Chye, Anna Pick Kiong Ling, Yin Yin Ooi, Rhun Yian Koh

THE ROLES OF ANTIFIBROTIC THERAPIES IN POST-SARS-CoV-2 INFECTION

Abstract 

Coronavirus Disease 2019 (COVID-19) pandemic, caused by the severe acute respiratory syndrome coronavirus type 2 (SARS-CoV-2), has affected over a hundred million people worldwide. Other than acute symptoms after infection, the patients are also suffering from long-term health complications associated with COVID-19 called long COVID or post-COVID conditions by which pulmonary fibrosis (PF) was observed in one-third of the patients. Since post-COVID-19-associated PF (PCPF) shares similar symptoms with idiopathic pulmonary fibrosis (IPF), the ongoing studies focus on the potential use of therapeutic approaches for IPF in PCPF patients. Hence, this study summarises the potential roles of these therapies to treat the PCPF including antifibrotic drugs, mesenchymal stem cell (MSC) therapy and inhaled curcumin nanoformulations by assessing their efficacies for the PCPF treatment.

Full text

Page 83 - 89

Sri Widyarti, Bayu Dwi Prakoso, Shifaaun Najihah, Syahputra Wibowo, Zakia Hasna Fajar, Sofy Permana, Sutiman Bambang Sumitro

PHYSICOCHEMICAL CHARACTERIZATION OF ASTAXANTHIN-Cu COMPLEXES

Abstract 

Astaxanthin (ASX) is a natural biological antioxidant acceptable as a dietary supplement and food colorant. ASX has unique molecular characteristics which form stable formations in the presence of metal ions. This study aims to analyze the astaxanthin-Cu complex using FTIR, SEM-EDS, and XRD. The synthesis of the complex carried on ratios 1:1, 1:2, and 2:1. Complex formation was determined using UV-Vis spectrum and then confirmed using FTIR. Although the profile spectrum UV-Vis has no differences between ratios, FTIR analysis showed an interaction between ASX with Cu. The SEM-EDS microstructure analysis showed that the ASX-Cu complex is a more regular form than astaxanthin alone. The analysis results based on X-ray diffraction showed that the crystal of astaxanthin, Cu, and each complex had different structures, asymmetric, and atomic arrangements. In conclusion, the ASX-Cu complex with a ratio of 1:1, 1:2, and 2:1 has been successfully made at the incubation time of 5 minutes at 20 degrees C.

Full text

Page 90 - 97

Aliyya Suci Arizona, Wira Eka Putra, Hendra Susanto, Sustiprijatno, Arief Hidayatullah, Muhammad Fikri Heikal, Diana Widiastuti

IN SILICO INVESTIGATION OF MUNG BEAN (Vigna radiata L.) ACTIVE COMPOUNDS AS POTENTIAL NATURAL INHIBITOR AGAINST HEPATITIS C VIRUS E2 ENVELOPE GLYCOPROTEIN

Abstract 

The hepatitis C virus (HCV) is the causative agent of hepatitis C, an infection of the liver. The liver may suffer long-term damage as a result of this illness. A significant number of people in Indonesia are infected with hepatitis C. Because of the restrictions and potential side effects of their hepatitis C treatment, a large number of people decide to stop receiving medication. Traditional remedies made from plants have started to become more popular in recent years due to the fact that they are less expensive and have fewer adverse effects. Thus, in this present study, we aimed to evaluate the Vigna radiata active constituent as a possible anti-viral drug against Hepatitis C Virus Envelope E2 Glycoprotein through in silico approaches. The Lipinski rule of five is used in the process of virtually screening compounds to identify those that have properties similar to candidates of the drug. Following that, the target chemicals and proteins were adjusted in preparation for additional molecular docking. In order to get binding affinity scores, chemical interactions, ligand sites, and amino acid residues, visualization and data analysis were carried out. Based on our investigation, we found the top five molecules with lower binding energy values than IFN-α as control drugs including isovitexin, orientin, vitexin, caffeic acid, and p-coumaric acid. In addition, the findings demonstrated that the chemical bonds that facilitate the contact process are present in every substance that forms a binding interaction with the target protein. As a result, our findings provide preliminary evidence that the V. radiata plant has the potential to act as an anti-viral medicine that is effective against hepatitis C virus E2 envelope glycoprotein.

Full text

Page 98 - 112

Muhammad Syahmi Abd Rahman, Zixin Hong and Nadiya Akmal Baharum

IN SILICO CHARACTERIZATION OF DEFENSIN IN Musa acuminata DH PAHANG (MaDef) PROVIDES INSIGHT INTO POTENTIAL DEFENCE-RELATED PROTEIN

Abstract 

Plant defensins are expressed in response to phytopathogens and various defence-related signalling molecules. They possess diverse biological properties such as antifungal, antibacterial and proteinase inhibitory, as well as playing roles in plant growth and development. Multiple defensin copies are identified in numerous plant species, such as Arabidopsis, Brassica oleracea, Zea mays and Medicago truncatula. To our knowledge, the multigene family of defensin has never been reported in bananas. In addition, specific banana defensin genes involved in the defence and stress responsiveness are yet to be identified. Thus, this study predicts specific copies of Musa acuminata DH Pahang (wild banana) defensins that are potentially involved with defence and biotic stress response using in silico analysis. A total of 6 defensin copies from Musa acuminata DH Pahang (wild banana) (MaDef) were identified and categorised under the Knottin_1 clan (CL0054). All of them except Ma07_t03680.1 carry conserved sequences of the gamma-thionin domain (PF00304). A total of 8 cysteines forming 4 disulfide bridges are found across all six MaDef peptide sequences. Using phylogenetic analysis, wild banana defensins are categorised under three clades with a predicted molecular weight of 8 to 9 kDa. Gene ontology (GO) revealed that all MaDefs except for Ma07_t03680.1 are involved in defence response. Furthermore, analysis of the promoter regions through PlantCARE shows Ma04_t36140.1 is associated with defence and stress responsiveness. Overall, this study contributes to a deeper understanding of defensins characteristics and functional predictions, which are critical for future crop advances against biotic challenges, notably in bananas.

Full text

Page 113 - 121

Sien-Yei Liew, Noraini Abd-Aziz, Eric J Stanbridge, Khatijah Yusoff, Norazizah Shafee, Suhaili Mustafa

ESTABLISHMENT OF A HIGHLY SENSITIVE CELL-BASED ASSAY FOR SCREENING OF HYPOXIA-INDUCIBLE FACTOR REGULATORS

Abstract 

Cell-based assay is a powerful tool in the field of drug discovery. One of the main targets of drug development is transcription factors. Hypoxia-inducible factors (HIFs) are transcription factors involved in cellular oxygen homeostasis and associated with disease pathophysiology. Currently, a highly sensitive cell-based assay to measure HIF activity is still lacking. Using luciferase reporter constructs, we developed a highly sensitive, stable reporter cell line for monitoring the activity of HIF. Four copies of hypoxia response element (HRE) of the erythropoietin (EPO) gene, which is one of the targets of HIF, were used to drive the expression of the luciferase reporter. This stable reporter cell line gave a 500-fold increase in the luciferase signal in hypoxia compared to a normoxia condition. This robust increase in hypoxia response is crucial to ensure consistency and reproducibility of HIF assay results while reducing the overall assay cost. The establishment of this highly sensitive cell-based HIF assay may help expedite research in the discovery of HIF regulatory drugs.

Full text

Page 122 - 134

Tran Thi Phuong Nhung, Le Pham Tan Quoc

ASSESSMENT OF TOXIC EFFECTS OF Hedyotis capitellata WALL. LEAVES ETHANOL EXTRACT VIA BIOLOGICAL ASSAYS IN MICE (Mus musculus)

Abstract 

Hedyotis capitellata Wall. is a traditional plant known for its various significant pharmacological effects, such as gastric protection, pain relief, anti-inflammatory properties, etc. Despite its wide usage in traditional medicine, no scientific studies have been published on its toxicity. The current study evaluated the potential toxicity of ethanol leaf extract of H. capitellata (EtHC) through acute and sub-chronic oral administration in mice following guidelines 423 and 408 of the OECD for chemical testing. To assess the acute toxicity of EtHC, single doses of 1000, 3000, and 5000 mg/kg body weight were administered to mice and continuously observed for 14 days. Additionally, daily doses of 100, 300, and 500 mg/kg body weight were also given to mice for 90 days to investigate sub-chronic toxicity. At the end of the study, blood, urine, and vital organs were collected for haematological, biochemical, urine analysis, and histopathological studies. The results demonstrated no cases of mortality or signs of toxicity observed in the acute toxicity test. Throughout the 90-day study period, all tested extract doses exhibited no harmful effects on the organs. Haematological and biochemical parameters in the acute toxicity (5000 mg/kg) and subchronic toxicity (500 mg/kg) groups (e.g., red blood cell count: 6.59 ± 0.41 × 106 cells/mm3, aspartate aminotransferase (AST) level: 16.62 ± 0.31 U/L, alanine aminotransferase (ALT) level: 18.15 ± 0.58 U/L, urine (pH 7.05 ± 0.09, specific gravity 1.17 ± 0.11) did not significantly differ from the control group (p > 0.05). However, individual differences were observed in the white blood cell count (EtHC5000 group) and glucose level (EtHC500 group) compared to the control group (p < 0.05). These changes were considered individual variations and not biologically significant. Histopathological examination of the organs also revealed no abnormalities in the extract-treated group. This study demonstrates that the ethanol leaf extract of H. capitellata is non-toxic and could be considered for treating various diseases, such as pain relief, anti-inflammatory effects, gastric ulcer treatment, etc.

Full text

Page 135 - 151

Nur Athirah Zabidi, Muhajir Hamid, Mohd. Ezuan Khayat, Mohd Badrin Hanizam Abdul Rahim, Shafinaz Abd Gani

TOWARDS A NOVEL BIO-INSPIRED DRUG DELIVERY SYSTEM: EXOSOMES LOADED WITH POLYPHENOLS AS NATURAL DRUG CARRIERS IN DIABETES TREATMENT

Abstract 

Polyphenols have been used as active ingredients in pharmaceuticals, healthcare goods, and dietary supplements to improve the functional properties of food. They have been widely investigated as an antidiabetic agent in vitro and in vivo studies. Polyphenols are known to exert antidiabetic properties as a potent inhibitor or as an activator to minimize β-cell dysfunction and insulin resistance in Diabetes Mellitus (DM). Nevertheless, due to some impaired characteristics such as low bioavailability, rapid elimination from the body, high-rate metabolisms, poor absorption due to hydrophobic properties, and less stability, these compounds are prevented from performing their optimal therapeutic activities. Exosomes, nanoparticles made from different types of cells, have a great deal of potential to be one of the promising carriers in drug delivery systems to address these problems (DDS). To date, exosome exhibits particular benefits as a natural drug delivery agent in terms of specificity, stability, and safety that mediate the synergistic effect between polyphenols and diabetes. Exosomes have recently been used as a novel medication delivery method, increasing the effectiveness and efficiency of the drug delivery system. According to certain studies, exosome-nano encapsulating polyphenols could improve their biological effect in terms of bioavailability and bioaccessability. In addition, accumulated evidence illustrates that nanoencapsulation of polyphenols with exosomes enhances metabolic pathways in DM progression. In this review, we explore the effect of polyphenols encapsulated with exosomes concerning their beneficial effect on DM management.

Full text

Page 152 - 162

Vi Sion Chang, Yong Hui Wong, Kumar Veerapen, Zoe Yi Ng, Wei Min Hon, Renee Lay Hong Lim

ASSOCIATION OF TGFB1 rs1800470 AND TGIF rs2229333 VARIANTS WITH MYOPIA IN MALAYSIAN ADOLESCENTS

Abstract 

Myopia is a global disease with high prevalence in school children. This study aimed to investigate the prevalence of myopia and its association with variants TGFB1 rs1800470 and TGIF rs2229333 among Malaysian adolescents. A total of 565 Malaysian adolescents (206 Chinese, 220 Malay, and 139 Indian) were recruited and refractive error measurements were used for grouping subjects to normal or myopes (≤-0.50D). Concurrently, genomic DNA from buccal cells was genotyped using conventional PCR-RFLP. Allelic and genotype frequency in association with myopia prevalence were statistically analysed. High myopia prevalence (83.0%) was detected in the study population, with females (85.8%) being more myopic than males (78.8%). The highest prevalence of myopia was observed in Chinese (87.4%) followed by Malay (82.3%) and Indian (77.7%) (p<0.001) adolescents. In TGFB1, T allele was the minor allele in the Chinese and Malays but not Indians, whereas in TGIF, T was the minor allele in all ethnic groups. Interestingly, myopes compared to normal showed higher frequency for CT or combined (CT+CC) genotype for TGFB1, but only Malay males showed significantly higher CT (p=0.033, relative risk=1.23) and (CT+CC) (p=0.009, OR (95% CI) = 4.23) respectively. Despite the higher frequency of combined (CT+TT) genotype for T risk allele of TGIF observed for myopes, no significant association with myopia was detected. The genotype and allele frequency of both variants differed based on sex and ethnicity. This is the first study demonstrating a significant association of the TGFB1 variant with myopic Malay male adolescents, and no association between TGIF variant and myopia in this study population.

Full text

bottom of page